Sage Journals: Discover world-class research

Abstract

Background:

Patients with β-thalassemia major remain at risk for endothelial dysfunction and cardiac injury due to iron overload, oxidative stress, and chronic inflammation, even with iron-chelation therapy. Assessing vascular and cardiac serum biomarkers provides a practical tool to understand disease mechanisms and guide management.

Objectives:

This study aims to identify reliable diagnostic markers for endothelial dysfunction in β-thalassemia major patients, a known risk factor for cardiovascular disease.

Design:

Case–control, cross-sectional study.

Methods:

Serum markers of endothelial dysfunction and cardiac damage, along with lipid profiles, were assessed. In addition, the expression of genes encoding enzymes related to cellular antioxidant defense and ferroptosis was evaluated.

Results:

Sixty transfusion-dependent β-thalassemia major patients on iron-chelation therapy and 20 healthy controls participated in the study. Significant differences among control, splenectomized, and non-splenectomized β-thalassemia groups were observed for erythrocyte sedimentation rate (ESR), high mobility group box 1 (HMGB-1), interleukin-10 (IL-10), interleukin-18, fibroblast growth factor 21 (FGF21), soluble suppression of tumorigenicity 2 (sST2), and soluble vascular cell adhesion molecule-1 (sVCAM-1), but not interleukin-23, interleukin-33, or calprotectin. Receiver operating characteristic (ROC) analysis showed AUCs of 0.991, 0.990, 0.848, and 0.831 for IL-10, ESR, sST2, and sVCAM-1, respectively (p < 0.05). Hypertriglyceridemia with decreased low-density lipoprotein and total cholesterol was noted in β-thalassemia groups. The expression of SLC7A11, KEAP1, and HO-1 genes was elevated, while NRF2 and GPX4 showed no significant change. HO-1 showed a significant inverse correlation with HMGB-1 (r = −0.405, p = 0.001), KEAP1 was positively correlated with sST2 (r = 0.282, p = 0.029), and GPX4 was correlated with FGF21 (r = 0.255, p = 0.049); no other significant associations were found.

Conclusion:

β-thalassemia major patients exhibit significant endothelial and cardiac injury markers, altered lipid profiles, and selective upregulation of antioxidant and ferroptosis-related genes.

Plain language summary

Endothelial dysfunction in patients with β-thalassemia major

People with beta thalassemia major disease have a serious inherited blood disorder. Their bodies can’t produce enough healthy red blood cells. To stay alive, they need regular blood transfusions. Because their red blood cells are abnormal their body breaks them easily liberating iron. Over time, these transfusions yield too much iron that builds up in their bodies causing harm to the heart and blood vessels. This study was conducted to find early warning signs of damage to the heart or blood vessels. Sixty patients with beta thalassemia major participated in the study; forty-four of them had their spleens removed to minimize red blood cell damage. In addition, twenty healthy volunteers participated in the study for comparison purposes. The study found that two blood markers among eleven tested were much higher in people with thalassemia than in healthy people. These substances tend to rise when the heart or blood vessels are under stress. In addition, it was found that some genes in the body react to stress. These genes were more active in people with thalassemia because the body is trying to protect itself. To sum up, the findings suggest that certain markers could help doctors identify early signs of heart and blood vessel problems in people with beta thalassemia major. Therefore, it is recommended to use these tests in regular check-ups to find complications early and improve patient care.

Keywords

β-thalassemia major endothelial dysfunction splenectomy sST2 sVCAM-1

Introduction

Patients with β-thalassemia major typically exhibit severe anemia during early childhood, necessitating lifelong treatment with regular transfusions for survival.^1,2 Transfusion-related iron overload has been linked to the development of cardiovascular complications, such as cardiac dysfunction and vascular abnormalities.³ Despite progress in iron chelation therapy, secondary iron overload remains a significant challenge in β-thalassemia.⁴

Endothelial dysfunction and arterial stiffness in β-thalassemia are caused by several factors including iron overload and intravascular hemolysis leading to an increase in free heme.⁵ These conditions reduce nitric oxide (NO) bioavailability either directly by inhibiting endothelial NO synthase or indirectly through oxidative stress⁶ and lipid peroxidation products.⁷ Although iron chelation therapy is routinely used, iron accumulation often persists and contributes to vascular complications even in asymptomatic patients. These individuals exhibit increased levels of inflammatory markers, such as interleukin-6 (IL-6), soluble vascular cell adhesion molecule-1 (sVCAM-1), and soluble intercellular adhesion molecule-1 (sICAM-1), indicating ongoing endothelial activation and systemic inflammation.⁶ Additionally, inflammatory factors are increased in β-thalassemia due to factors such as frequent transfusions, infections, cytokines present in stored allogeneic blood, and the activity of stromal cells in hyperplastic bone marrow.⁸ Moreover, patients with β-thalassemia may have an elevated risk of premature atherosclerosis due to dyslipidemia.⁹

This increased oxidative stress and inflammation in β-thalassemia patients highlight the need for adaptive mechanisms to maintain cellular redox balance. One proposed mechanism involves the upregulation of SLC7A11, which supports cellular adaptation to oxidative stress and maintains redox homeostasis.¹⁰ The KEAP1-NRF2-AP-1 (activator protein-1)/ARE (antioxidant response element) signaling pathway increases the transcription of genes responsible for resistance to oxidative stress, including SLC7A11.¹¹ Under normal conditions, NRF2 is unstable and undergoes ubiquitination by the E3 ubiquitin ligase KEAP1. However, oxidative stress disrupts NRF2 degradation by KEAP1, enabling NRF2 to bind to the ARE, where it plays a role in antioxidant defense and redox regulation. It has been suggested that KEAP1 inactivation may promote ferroptosis resistance following SLC7A11/cysteine/glutathione axis activation by stabilizing NRF2 and NRF2 target genes.¹² NRF2 may also mediate ferroptosis resistance by regulating genes associated with glutathione biosynthesis, iron metabolism, and antioxidant defense mechanisms.¹³

This study compares the levels of 11 biomarkers related to endothelial function, cardiac damage, and inflammation in splenectomized, non-splenectomized, and apparently healthy controls. In addition, it evaluates the lipid profile and gene expression of antioxidant proteins. Its aim is to identify reliable diagnostic biomarkers for endothelial dysfunction in transfusion-dependent β-thalassemia major patients, who are at an increased risk for cardiovascular disease. By evaluating specific serum biomarkers with the highest sensitivity and specificity, the study seeks to enhance the risk assessment, and clinical management of cardiovascular complications in these patients.

Methods

The study was conducted in accordance with the ethical principles of the Declaration of Helsinki (1975, as revised in 2024). Ethical approval for this prospective study was obtained from the Institutional Review Board (IRB) of the Ministry of Health, Amman, Jordan (Approval Number IRB #138888, approved on August 17, 2022). Written informed consent was obtained from all adult participants and from the parents or legal guardians of underage participants prior to inclusion in the study. All patient data were de-identified and anonymized before analysis to ensure confidentiality and privacy.

Study design and participants

This study comprised Jordanian participants, aged 7–35 years and of both genders, who were selected from patients attending the Thalassemia and Thrombophilia Clinic at Al-Zarqa Governmental Hospital, Al-Zarqa, Jordan. Patients were diagnosed with β-thalassemia major based on hemoglobin gel electrophoresis and confirmed by high-performance liquid chromatography analysis.

The control group included age- and sex-matched individuals without a personal or family history of thalassemia, and no signs of chronic illness, confirmed via physical examination, complete blood count (CBC), liver function, other biochemical analysis, and viral serology testing. β-Thalassemia major patients were eligible if they had maintained clinical stability for at least 4 weeks prior to enrollment and had not undergone splenectomy within the preceding 6 months. Participants were excluded if found to have other forms of hemoglobinopathies, a prior history of gene therapy or bone marrow transplantation, renal impairment, active infectious diseases (such as hepatitis B/C or HIV), inadequate adherence to treatment or follow-up, or incomplete clinical data. Electronic medical records were reviewed to collect demographic and diagnostic data, including age, sex, and time of diagnosis. Body mass index (BMI) was calculated as body weight divided by the square of height.

Blood sample collection

Blood sampling was performed between 10:00 and 12:00 a.m., prior to the scheduled transfusion and approximately 4 weeks following the last transfusion session. A 5 mL of whole blood was drawn into EDTA-containing tubes for subsequent gene expression analysis, while an additional 10 mL was collected in plain tubes to obtain serum for laboratory investigations. The following lab tests were performed Calprotectin (Human Calprotectin L1/S100-A8/A9 Complex catalogue No. EH62RB, Invitrogen; ThermoFisher Scientific, Waltham, USA), erythrocyte sedimentation rate (ESR), fibroblast growth factor 21 (FGF 21; Human FGF-21 Kit Catalogue No. EH188RB, Invitrogen; ThermoFisher Scientific,Waltham, USA), high mobility group box 1 (HMGB-1; Human High mobility group protein B1 (HMGB-1) ELISA Kit Catalogue No. MBS262266; My BioSoruce, San Diego, USA), interleukin-10 (IL-10; Human Il-10 ELISA kit, catalogue No. BMS215HS HU, Invitrogen; ThermoFisher Scientific,Waltham, USA), interleukin-18 (IL-18; Human HS-IL-18 Accquant ELIZA kit; Fine Test,Wuhan, Hubei, China), interleukin-23 (IL-23; Human IL-23 ELIZA kit catalogue No. EK711087, AFG Bioscience; Thomas Scientific, USA), interleukin-33 (IL-33; Human HS-IL-33 ELIZA kit catalogue No. EH0198; Fine Test, Wuhan, Hubei, China), soluble suppression of tumorigenicity 2 (sST2; MBS8807674 Soluble Suppression of Tumorigenicity kit; My BioSource, San Diego, USA), and sVCAM-1 (/CD106; Human sVCAM-1/CD106 ELISA Kit catalogue No. MBS2505831; My BioSource, San Diego, USA). Lipid profile was measured using Cobas C501 Chemistry analyzer (Roche Diagnostic, Rotkeruz, Switzerland).

Hemoglobin electrophoresis

Hemoglobin fraction analysis was carried out using the Hydragel 15 Hemoglobin kit (Sebia, Lisses, France) on the Hydrasys 2 Scan system, according to the manufacturer’s instructions. Briefly, peripheral blood samples were collected in EDTA tubes and lysed to release hemoglobin. The lysates were applied to an agarose gel matrix, and electrophoresis was conducted under alkaline conditions (pH ~8.6) to separate hemoglobin variants based on their electrophoretic mobility. After the gel is run, it is fixed, stained, and scanned using the Hydrasys 2 system, which measures the amount of each type of hemoglobin. Different hemoglobin types (HbA, HbF, HbA2, and any abnormal variants) are identified based on how they move in the gel and their relative amounts. A diagnosis of β-thalassemia major is made when HbA is absent or very low, HbF is greatly increased (usually over 90%), and HbA2 is normal or slightly elevated.

Troponin I measurement

Troponin I levels were measured to detect heart muscle injury using a Flowflex lateral flow test cartridge (ACON Biotech, Hangzhou, China). Serum (80 µL) was applied to the sample well and the sample migrated along the membrane by capillary action. Troponin I, if present, binds to colloidal gold-labeled antibodies. The resulting immunocomplexes are captured at the test line, producing a visible signal. Results are visually interpreted after 15 min. The appearance of a control line confirms test validity.

RNA isolation and reverse transcription

Peripheral whole blood samples were first processed for total RNA extraction using Direct-zol RNA Purification Kit (Zymo Research, Murphy Ave, Irvine, USA), as per the manufacturer’s recommended procedure. The downstream procedures, including complementary DNA (cDNA) synthesis and quantitative real-time PCR (qRT-PCR), were conducted as previously described in our published methodology.¹⁴ Primers used for gene amplification were procured from Integrated DNA Technologies (IDT, Coralville, IA, USA), as detailed in Table 1. For cDNA synthesis, the PrimeScript™ RT Master Mix Kit (Takara, Shiga, Japan) was employed, following the protocol supplied by the manufacturer and after assessment of the extracted RNA purity and concentration by NABI spectrophotometer (MicroDigital, Seoul, Korea).

Table 1.

Sequences of the qRT-PCR primers.

Gene	Forward 3′-5′	Reverse 3′-5′
GPX4	ACAAGAACGGCTGCGTGGTGAA	GCCACACACTTGTGGAGCTAGA
NRF2	CAGCGACGGAAAGAGTATGA	TGGGCAACCTGGGAGTAG
KEAP1	AGAAGTCCAAAGCGGGAA	CTATTACCCGGCCAGAGG
SLC7A11	TCTCCAAAGGAGGTTACCTGC	AGACTCCCCTCAGTAAAGTGAC
HO-1	GAGACGGCTTCAAGCTGGTGATG	GTTGAGCAGGAACGCAGTCTTGG
GAPDH	AATGCCTCCTGCACCACCAAC	AAGGCCATGCCAGTGAGCTTC

GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GPX4, glutathione peroxidase 4; HO-1, heme oxygenase-1; KEAP1, Kelch-like ECH-associated protein 1; NRF2, nuclear factor erythroid 2-related factor 2; qRT-PCR, quantitative real-time PCR; SLC7A11, solute carrier family 7 member 11.

Quantitative PCR analysis of gene expression

qRT-PCR was carried out using the QuantGene 9600 real-time PCR system (Bioer Technology, Hangzhou, China) in combination with the TB Green^® Premix Ex Taq™ II reagent (Takara). qPCR reaction was performed in a final volume of 20 µL containing 2 µL of cDNA (~60 ng), 10 µL of TB Green mix, 2 µL of primers (10 pmol/µL), and 6 µL of nuclease-free water. The thermal profile included an initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s. Expression levels of target genes were normalized using GAPDH as the reference gene, and relative expression was calculated via the 2^−∆∆Ct method.

All available specimens from the control and patients were included in the gene expression analysis. Since gene expression profiles are not influenced by splenectomy status, the statistical evaluation was performed by comparing the β-thalassemia group as a whole with the control group, without subdividing based on splenectomy.

Statistical analysis

Data analysis was conducted using SPSS version 26 (SPSS Inc., Chicago, USA) for Windows. The Kolmogorov–Smirnov test was used to check whether the data followed a normal distribution. Only high-density lipoprotein (HDL), cholesterol, BMI, and sST2 showed a normal distribution. For these normally distributed variables, we used one-way ANOVA followed by Tukey’s post hoc test. Non-normal variables were compared using the Kruskal–Wallis test with Bonferroni correction. Post hoc pairwise comparisons were conducted for all possible pairs, and a p-value below 0.05 was considered statistically significant.

The Chi-square test was used to assess differences in sex, while age, which was not normally distributed, was compared between the β-thalassemia major and control groups using the Mann–Whitney U test. The Mann–Whitney U test was also applied to compare gene expression levels of enzymes. Spearman’s correlation coefficient was calculated using two-tailed bivariate correlation analysis. Receiver operating characteristic (ROC) curve analysis was performed to determine the area under the curve (AUC), reflecting the diagnostic performance of each marker. For ROC analysis, splenectomized and non-splenectomized β-thalassemia patients were combined into a single group. This was done to evaluate the overall diagnostic performance of the studied markers in β-thalassemia, irrespective of splenectomy status. The reporting of this study conforms to the Strengthening the Reporting of Observational Studies in Epidemiology (Vandenbroucke, #1653) statement.¹⁵

Results

Demographic and clinical characteristics

This study included 60 β-thalassemia major patients (30 males and 30 females) and 20 controls. No significant difference in age or sex between β-thalassemia major and control groups was found (p = 0.395 and 0.689, respectively). The ages of β-thalassemia patients ranged from 7 to 35 years old with an average age of 22.09 ± 6.39 years in splenectomized group (n = 44) and 15.06 ± 5.48 years in non-splenectomized group. The control group consisted of 20 healthy volunteers (9 males:11 females) with a mean of 19.10 ± 7.00 years (range 10–35 years). BMI was 21.23 ± 1.28, 21.93 ± 2.30, and 20.43 ± 3.24 kg/m² for control, splenectomized, and non-splenectomized β-thalassemia groups, respectively. BMI did not differ significantly between the three groups.

All patients with β-thalassemia major were receiving iron chelation therapy. Among them, 36 out of 60 were treated with deferiprone (75 mg/kg/day), 19 patients received deferasirox (500 mg once daily), and 5 patients were on deferoxamine injections. The chelation regimen and dosage were determined according to serum ferritin levels and body weight. In addition, most patients were also prescribed furosemide, a diuretic. All β-thalassemia major patients had regular blood transfusions. All patients and controls tested negative for Troponin I.

Endothelial dysfunction indicators and inflammatory markers among control and β-thalassemia groups

A significant difference was observed among the three groups—splenectomized, non-splenectomized β-thalassemia, and the control group—in ESR, FGF21, HMGB-1, IL-10, IL-18, sST2, and sVCAM-1 levels (Table 2). Conversely, no significant differences between the three groups in Calprotectin, IL-23, and IL-33 were found.

Table 2.

Endothelial and cardiac damage indicators and inflammatory markers in control, splenectomized, and non-splenectomized β-thalassemia major groups.

Variable	Splenectomized β-thalassemia (mean ± SD)	Non-splenectomized β-thalassemia (mean ± SD)	Control (mean ± SD)	p-Value^a
Calprotectin (ng/mL)	737.53 ± 816.09	335.14 ± 252.43	600.36 ± 533.49	0.300
ESR (mm/h)	77.48 ± 35.94	63.38 ± 29.60	12.38 ± 2.40	0.0001
FGF21 (pg/mL)	916.3 ± 595.6	732.0 ± 511.6	415.0 ± 246.2	0.047
HMGB-1 (ng/mL)	0.18 ± 0.057	0.21 ± 0.03	0.14 ± 0.09	0.004
IL-10 (pg/mL)	12.24 ± 23.41	11.15 ± 20.18	1.77 ± 0.83	0.0001
IL-18 (pg/mL)	129.8 ± 56.23	108.9 ± 49.30	60.12 ± 32.59	0.001
IL-23 (pg/mL)	649.2 ± 1644	187.6 ± 248.1	185.9 ± 347.4	0.163
IL-33 (pg/mL)	236.7 ± 397.7	292.8 ± 429.1	386.0 ± 493.5	0.287
sST2 (ng/mL)	495.6 ± 101.2	526.7 ± 92.33	336.2 ± 129.4	0.0001
sVCAM-1 (µg/mL)	5.62 ± 10.91	5.08 ± 13.28	0.67 ± 0.40	0.0001

p-Values indicate significance for the overall comparison among all groups, as determined by ANOVA or Kruskal–Wallis test. Bolded p-values indicate statistical significance.

ESR, erythrocyte sedimentation rate; FGF 21, fibroblast growth factor 21; HMGB-1, high mobility group box 1; IL-10, interleukin-10; IL-18, interleukin-18; IL-23, interleukin-23; IL-33, interleukin-33; sST2, soluble suppression of tumorigenicity 2; sVCAM-1/CD106, soluble vascular cell adhesion molecule-1.

ESR, IL-10, and sST2 were significantly elevated in splenectomized and non-splenectomized β-thalassemia major groups compared to control (p < 0.0001 for each) while no significant difference was found between the two thalassemia groups (Figure 1). FGF21 and sVCAM-1 were significantly higher in splenectomized group compared to control (p = 0.014 and p < 0.0001, respectively) while no significant difference was found between the two thalassemia groups or between the non-splenectomized group and the control. Conversely, HMGB-1 was significantly higher in non-splenectomized group compared to control (p = 0.001) while no significant difference was found between the two thalassemia groups or between the splenectomized group and the control. IL-18 was significantly higher in splenectomized and non-splenectomized β-thalassemia major groups relative to control (p < 0.0001 and p = 0.004, respectively), with no significant difference between the two thalassemia groups (Figure 1).

Figure 1.

Scatter-plot representation of endothelial dysfunction indicators and inflammatory markers in control, splenectomized, and non-splenectomized β-thalassemia major groups. Post hoc test p-values are indicated, and the central line represents the median.

Receiver operating analysis

The receiver operating analysis was performed to specify the best makers that distinguish β-thalassemia major patients from the control group. IL-10 and ESR had excellent specificity and sensitivity while sST2 and sVCAM-1 had good one. The AUC was 0.991, 0.990, 0.848, and 0.831 for IL-10, ESR, sST2, and sVCAM-1, respectively (p < 0.05 for all; Figure 2). Other parameters had fair, poor, or no sensitivity or specificity. For IL-10, the cutoff 2.25 pg/mL has 100% sensitivity and 85.0% specificity while for ESR, the cutoff 17.5 mm/h had 98.3% sensitivity and 100% specificity.

Figure 2.

ROC for tested markers that distinguish β-thalassemia major patients from control subjects.

Lipid profile

A significant difference between the three studied groups in total cholesterol, triglycerides, low-density lipoprotein (LDL), and HDL level was found (p = 0.0001 for each, Table 3). Triglyceride concentrations were significantly elevated in both splenectomized and non-splenectomized β-thalassemia major patients compared with controls (p < 0.0001 and p = 0.005, respectively), with no significant difference between the two thalassemia subgroups (Figure 3). Total cholesterol levels were significantly reduced in splenectomized and non-splenectomized patients relative to controls (p = 0.006 and p < 0.0001, respectively), while no difference was observed between the patient subgroups. Similarly, LDL concentrations were significantly lower in both β-thalassemia groups compared with controls (p = 0.001 and p < 0.0001, respectively), without variation between the two thalassemia groups. HDL levels were significantly lower in both patient groups compared with controls (p < 0.0001 for each), again with no significant difference between the two thalassemia groups (Figure 3).

Table 3.

Lipid profile in control, splenectomized, and non-splenectomized β-thalassemia major groups.

Variable	Splenectomized β-thalassemia (mean ± SD)	Non-splenectomized β-thalassemia (mean ± SD)	Control (mean ± SD)	p-Value^a
Triglycerides (mg/dL)	150.45 ± 64.49	146.25 ± 78.55	95.75 ± 53.05	0.0001
Total cholesterol (mg/dL)	124.48 ± 30.16	106.62 ± 25.73	149.78 ± 24.96	0.0001
LDL (mg/dL)	64.40 ± 24.41	53.65 ± 15.66	86.43 ± 21.61	0.0001
HDL (mg/dL)	34.53 ± 10.16	29.61 ± 5.02	46.86 ± 9.52	0.0001

p-Values indicate significance for the overall comparison among all groups, as determined by ANOVA or Kruskal–Wallis test. Bolded p-values indicate statistical significance.

HDL, high-density lipoprotein; LDL, low-density lipoprotein; SD, standard deviation.

Figure 3.

Lipid profile in control, splenectomized, and non-splenectomized β-thalassemia major groups. Data are presented as mean ± SD. Post hoc test p values are indicated.

Gene expression of proteins involved in cellular redox regulation and oxidative stress response

A significant difference in the gene expression of SLC7A11, KEAP1, and HO-1 was found between β-thalassemia major and the control group, while no significant difference in the expression of NRF2 and GPX4 was found between them (Table 4).

Table 4.

Gene expression of antioxidant proteins in control and β-thalassemia major groups.

Gene	β-Thalassemia major(mean ± SD)	Control (mean ± SD)	p-Value^a
SLC7A11	2.61 ± 2.13	1.29 ± 0.83	0.003
NRF2	2.49 ± 2.98	2.05 ± 2.92	0.284
KEAP1	2.23 ± 2.02	1.17 ± 0.99	0.020
GPX4	1.22 ± 0.84	1.04 ± 0.57	0.665
HO-1	5.94 ± 7.31	1.16 ± 0.63	0.0001

p-Values results from Mann–Whitney test. Bolded p-values indicate statistical significance.

GPX4, glutathione peroxidase 4; HO-1, heme oxygenase-1; KEAP1, Kelch-like ECH-associated protein 1; NRF2, nuclear factor erythroid 2-related factor 2; SLC7A11, solute carrier family 7 member 11.

Correlation between antioxidant proteins and cardiovascular damage indicators in β-thalassemia major

None of the studied parameters was significantly correlated with the gene expression of the studied antioxidant proteins except for the following significant correlations: HO-1 was significantly and inversely correlated with HMGB-1 (r = −0.405, p = 0.001), and KEAP1 was significantly and positively correlated with sST2 (r = 0.282, p = 0.029). Furthermore, GPX4 was positively correlated with FGF-21 (r = 0.255, p = 0.049).

Discussion

Compared with controls, ESR, IL-10, sST2, and IL-18 were significantly elevated in both splenectomized and non-splenectomized β-thalassemia major groups. FGF21 and sVCAM-1 were specifically increased in the splenectomized group, whereas HMGB-1 was elevated in the non-splenectomized group. ESR is a cheap and easy test that can be used as a non-specific marker of inflammation. IL-10 is an anti-inflammatory cytokine that is considered as a non-specific marker for endothelial damage. IL-10 prevents the impairment of endothelial dysfunction by suppressing pro-inflammatory signaling and functions as a key mediator of vascular protection in atherosclerosis.¹⁶ In patients with coronary artery disease, serum IL-10 levels act as an independent predictor of endothelium-dependent vasodilatory function.¹⁷ Previous studies reported an elevation in IL-10 in thalassemia patients and linked its levels to iron status.¹⁸ Despite that all thalassemia patients participated in the current study, including splenectomized and non-splenectomized patients, receive iron chelation therapy, their levels of IL-10 are still higher than the control.

In ROC analysis, sST2 and sVCAM-1 were the most sensitive and specific markers after ESR and IL-10. sST2 is a US-FDA-approved prognostic biomarker for predicting mortality in cases of chronic heart failure.¹⁹ sST2 functions as a decoy receptor to sequester free IL-33, thereby modulating inflammation and fibrosis in the heart.²⁰ The IL-33/ST2 pathway is active in the failing human heart and is linked to pro-fibrotic remodeling of the myocardium.²¹ Comparison of fibrosis biomarkers in chronic heart failure revealed a superiority of ST2 over another marker, galectin-3, in risk stratification.²²

Studies have shown that increased systemic inflammation in β-thalassemia patients is linked to endothelial dysfunction and cardiovascular risk factors, including aortic stiffness and elevated pulmonary artery pressure.²³ In our study, splenectomized thalassemic patients displayed notably an increase in markers of vascular activation and dysfunction like soluble adhesion molecules such as sVCAM-1. Similar findings were reported by others.²⁴ Splenectomy is associated with significant increase in intravascular hemolysis and elevations of inflammation markers and hypercoagulability.²⁵ The increase in sVCAM-1 in the present study agrees with other studies reporting higher VCAM-1 levels in thalassemia subjects compared to controls with a high significant correlation existed between VCAM-1 and ferritin.²⁶ This possibly illustrates that higher ferritin levels are possibly associated with oxidation stress due to iron overload resulting in endothelial injury. In β-thalassemia intermedia, it was reported that the vascular endothelium is activated as demonstrated by increased levels of sICAM-1, sVCAM-1, sE-SELECTIN. These markers indicate an enhanced capacity for leukocyte adhesion to the endothelium.²⁷

Another marker that was higher levels in thalassemia groups compared to control is FGF21. FGF21 is a hormone-like protein that offers cardioprotective action partly by regulating oxidative stress,²⁸ lipid metabolism, autophagy, and apoptosis. It has been proposed as a potential target for predicting and treating cardiovascular diseases.²⁹ However, the results of ROC analysis suggest that FGF21 has poor sensitivity and specificity. Its level was positively, but weakly, correlated with GPX4 gene expression suggesting a possible link between FGF21 and antioxidant proteins such as GPX4.

HMGB-1 levels in non-splenectomized thalassemia patients were higher than in the control. Similar to our findings, patients who underwent splenectomy had lower levels of HMGB1, compared with patients with an intact spleen.³⁰ Therefore, it has been suggested that HMGB1 represents a predictive factor for infectious events in thalassemia major patients.³⁰ An interesting finding of the present study is the presence of negative correlation between HO-1 and HMGB-1 (r = −0.405, p = 0.001). Further investigations are needed to explore the link between them.

IL-18 was higher in splenectomized and non-splenectomized thalassemia patients compared to control. IL-18 is a pro-inflammatory cytokine. One study from Iraq attributed the elevation in IL-18 in thalassemia patients to hepatitis C virus infection.³¹ However, in our study, all patients tested negative to this virus. Therefore, other inflammatory conditions may be responsible for IL-18 elevation.

Hypertriglyceridemia was observed in thalassemia patients compared to control with agreement with previous studies.²⁴ Moreover, low total and LDL cholesterol levels in β-Thalassemia were observed in this study as well as in other studies.²⁴ In patients with β-Thalassemia, accelerated erythropoiesis and increased cholesterol consumption are thought to be the primary mechanisms behind low LDL levels.³² Although the low LDL cholesterol levels observed in β-thalassemia may reduce the likelihood of developing atherosclerosis, the increased presence of oxidized LDL could still predispose these patients to atherosclerotic complications.⁵

The gene encoding SLC7A11 protein, as well as KEAP1, was significantly upregulated in our study in β-thalassemia patients compared to control. SLC7A11 is a transmembrane protein that forms the light chain of system xc−, facilitating the transport of extracellular cystine into cells for cysteine production and glutathione synthesis. It plays a crucial role in redox homeostasis by regulating cellular glutathione levels, which help mitigate oxidative stress and suppressing ferroptosis.¹⁰ HO-1 was also significantly upregulated in our study in β-thalassemia patients compared to control. HO-1 serves as a double-edged sword in thalassemia—helping to detoxify free heme and reduce oxidative stress but also contributing to iron overload.³³ The increased expression of SLC7A11 and HO-1 in patients with β-thalassemia major may represent an adaptive mechanism to counteract oxidative stress and endothelial dysfunction. The results suggest that SLC7A11, KEAP1, and HO-1 expression could serve as potential indicators of endothelial and cardiac injury, even though these markers are not unique to thalassemia. Many of these gene’s function as central regulators of oxidative stress and ferroptosis—processes that may play a crucial role in the development of vascular and myocardial damage.

This study has certain limitations. The relatively small cohort may have reduced the statistical power to detect some associations, and the cross-sectional design prevents conclusions about causality. To strengthen these findings, larger, multicenter longitudinal studies are needed.

Future directions and recommendation

Future studies should validate sVCAM-1 and sST2 as diagnostic markers for endothelial and cardiac damage in β-thalassemia major through larger, multicenter trials. Longitudinal research is needed to assess whether changes in these biomarkers predict cardiovascular outcomes.

Research should also explore how ferroptosis-related genes (SLC7A11, KEAP1, HO-1) contribute to vascular injury and oxidative stress and investigate therapies targeting these pathways to improve cardiovascular outcomes.

Integrating the assessment of biomarkers related to endothelial dysfunction, cardiac injury, and oxidative stress into routine clinical monitoring of β-thalassemia patients could enhance early detection and management. Collaboration between hematologists, cardiologists, and molecular researchers will be key to translating these findings into personalized care.

Conclusion

This study shows significant changes in inflammatory markers, vascular dysfunction indicators, and oxidative stress proteins in β-thalassemia major patients. Despite iron chelation, inflammation remains high. sST2 and sVCAM-1 effectively distinguish patients from healthy controls, with splenectomy linked to higher vascular activation. Dyslipidemia was observed, though low LDL may offer some protection.

At the molecular level, upregulation of SLC7A11 and KEAP1 suggests a compensatory response to oxidative stress, while HO-1 reflects both heme detoxification and iron overload. These findings highlight the interplay of inflammation, oxidative stress, vascular dysfunction, and iron metabolism, warranting further research into therapeutic strategies.

Footnotes

Acknowledgements

None.

Declarations

ORCID iDs

Ola M. Al-Sanabra

Manal A. Abbas

References

Almomani

Ala’a

Atoom

, et al. Evaluation of the validity of the pre-marriage mean corpuscular volume value as a predictive test for b-thalassemia carrier status. J Med Biochem 2023; 42: 195–205.

Nasir

Naseem

Ghazal

, et al. A comprehensive case study of deep learning on the detection of alpha thalassemia and beta thalassemia using public and private datasets. Sci Rep 2025; 15: 13359.

Adly

AAM

El-Sherif

Ismail

EAR

, et al. Vascular dysfunction in patients with young β-thalassemia: relation to cardiovascular complications and subclinical atherosclerosis. Clin Appl Thromb Hemost 2015; 21: 733–744.

Meloni

Pistoia

Spasiano

, et al. Oxidative stress and antioxidant status in adult patients with transfusion-dependent thalassemia: correlation with demographic, laboratory, and clinical biomarkers. Antioxidants 2024; 13: 446.

Hurtado

Sellak

Joseph

, et al. Accelerated atherosclerosis in beta-thalassemia. Am J Physiol Heart Circ Physiol 2023; 325: H1133–H1143.

Jiskani

. Extracellular vesicles in thalassemia: mechanisms, implications, and therapeutic potential. Asp Mol Med 2025; 5: 100061.

Akiki

Hodroj

Bou-Fakhredin

, et al. Cardiovascular complications in β-thalassemia: getting to the heart of it. Thalass Rep 2023; 13: 38–50.

Hahalis

Kremastinos

Terzis

, et al. Global vasomotor dysfunction and accelerated vascular aging in β-thalassemia major. Atherosclerosis 2008; 198: 448–457.

Jabbar

Hassan

Al-Naama

. Lipids profile in children and adolescents with β-thalassemia major. Hematol Transfus Cell Ther 2023; 45: 467–472.

10.

Lee

Roh

J-L

. SLC7A11 as a gateway of metabolic perturbation and ferroptosis vulnerability in cancer. Antioxidants 2022; 11: 2444.

11.

De la Vega

Chapman

Zhang

. NRF2 and the hallmarks of cancer. Cancer Cell 2018; 34: 21–43.

12.

Cao

Poddar

Magtanong

, et al. A genome-wide haploid genetic screen identifies regulators of glutathione abundance and ferroptosis sensitivity. Cell Rep 2019; 26: 1544–1556.e8.

13.

Anandhan

Dodson

Schmidlin

, et al. Breakdown of an ironclad defense system: the critical role of NRF2 in mediating ferroptosis. Cell Chem Biol 2020; 27: 436–447.

14.

Al-Sanabra

Haza

Hazàa

, et al. Comprehensive expression of long non-coding RNAs and association with the iron and erythropoiesis regulatory proteins in transfusion-dependent β-thalassemia. Arch Med Sci 2025; 21(6): 2671–2679.

15.

Von Elm

Altman

Egger

, et al. The Strengthening the Reporting of Observational Studies in Epidemiology (STROBE) statement: guidelines for reporting observational studies. Lancet 2007; 370: 1453–1457.

16.

Caligiuri

Rudling

Ollivier

, et al. Interleukin-10 deficiency increases atherosclerosis, thrombosis, and low-density lipoproteins in apolipoprotein E knockout mice. Mol Med 2003; 9: 10–17.

17.

Fichtlscherer

Breuer

Heeschen

, et al. Interleukin-10 serum levels and systemic endothelial vasoreactivity in patients with coronary artery disease. J Am Coll Cardiol 2004; 44: 44–49.

18.

Jawad

Ali

Zabibah

, et al. The association between IL-10 and iron status in children with beta thalassemia major. Biochem Cell Arch 2021; 21: 4507–4511.

19.

Sheng

J-M

, et al. IL-33/ST2 axis in diverse diseases: regulatory mechanisms and therapeutic potential. Front Immunol 2025; 16: 1533335.

20.

Griesenauer

Paczesny

. The ST2/IL-33 axis in immune cells during inflammatory diseases. Front Immunol 2017; 8: 475.

21.

Thanikachalam

Ramamurthy

Mallapu

, et al. Modulation of IL-33/ST2 signaling as a potential new therapeutic target for cardiovascular diseases. Cytokine Growth Factor Rev 2023; 71: 94–104.

22.

Bayes-Genis

De Antonio

Vila

, et al. Head-to-head comparison of 2 myocardial fibrosis biomarkers for long-term heart failure risk stratification: ST2 versus galectin-3. J Am Coll Cardiol 2014; 63: 158–166.

23.

Stoyanova

Trudel

Felfly

, et al. Vascular endothelial dysfunction in β-thalassemia occurs despite increased eNOS expression and preserved vascular smooth muscle cell reactivity to NO. PLoS One 2012; 7: e38089.

24.

Vinchi

Sparla

Passos

, et al. Vasculo-toxic and pro-inflammatory action of unbound haemoglobin, haem and iron in transfusion-dependent patients with haemolytic anaemias. Br J Haematol 2021; 193: 637–658.

25.

Atichartakarn

Chuncharunee

Archararit

, et al. Intravascular hemolysis, vascular endothelial cell activation and thrombophilia in splenectomized patients with hemoglobin E/β-thalassemia disease. Acta Haematol 2014; 132: 100–107.

26.

Al-Sarai

NAA

Al-Mudallal

Rai’d Najm

. Evaluation of serum vascular cell adhesion marker-1 in β-thalassemia major patients. Iraqi J Hematol 2025; 14: 81–87.

27.

Giuffrida

Parrinello

Figuera

. The hydroxyurea effects on plasma levels and surface expression of adhesion molecules ICAM-1 VCAM-1, E-SELECTIN and on plasma levels of protein C and protein S in patients with sickle cell disease and β-thalassemia intermedia. Blood 2008; 112: 5468.

28.

Planavila

Redondo-Angulo

Ribas

, et al. Fibroblast growth factor 21 protects the heart from oxidative stress. Cardiovasc Res 2015; 106: 19–31.

29.

Zhang

Liu

Long

X-X

, et al. The role of FGF21 in the pathogenesis of cardiovascular disease. Chin Med J 2021; 134: 2931–2943.

30.

Chirico

Lacquaniti

Piraino

, et al. Thalassaemia major and infectious risk: high mobility group box-1 represents a novel diagnostic and prognostic biomarker. Br J Haematol 2015; 171: 130–136.

31.

Hadi

Hamid

. The frequency of hepatitis C viral infections and its correlation with IL-12 and IL-18 among major thalassemic patients in Baghdad. Egypt J Chem 2022; 65: 593–600.

32.

Shalev

Kapelushnik

Moser

, et al. Hypocholesterolemia in chronic anemias with increased erythropoietic activity. Am J Hematol 2007; 82: 199–202.

33.

Yeudall

Upchurch

Leitinger

. The clinical relevance of heme detoxification by the macrophage heme oxygenase system. Front Immunol 2024; 15: 1379967.

Endothelial dysfunction and cardiac damage indicators in patients with β-thalassemia major under iron-chelation therapy